next up previous
Next: -a, Use ps_scan to Up: Parameters Previous: -r, Min match length

-s, Predict PBS by using which tRNA database, (filename)

To predict primer binding site, we need tRNA sequences, especially the 3' end 18nt of each sequences. LTR_FINDER can load tRNA of different species. A good tRNA set can be found at Genomic tRNA Database (http://lowelab.ucsc.edu/GtRNAdb/). Our database was download from Genomic tRNA Database on 2007-07-17. Here is an example of required format:

>Athal-chr4.trna25-AlaAGC (13454563-13454635)
GGGGATGTAGCTCAGATGGTAGAGCGCTCGCTTAGCATGCGAGAGGCACGGGGATCGATA
CCCCGCATCTCCA
LTR_FINDER uses the string after the last minus sign in sequence identifier field as the tRNA type name. In this example, `AlaAGC'.

2009-04-09