next up previous
Next: Summary output Up: Output format Previous: Output format

Full output & Summary output

An example of Full output format is presented as follows:
>Sequence: CHR2 Len:813138
[1] CHR2 Len:813138
Location : 29632 - 35590 Len: 5959 Strand:+
Score    : 9 [LTR match score:1]
Status   : 11111111100
5'-LTR   : 29632 - 29963 Len: 332
3'-LTR   : 35259 - 35590 Len: 332
5'-TG    : TG , TG
3'-CA    : CA , CA
TSR      : 29627 - 29631 , 35591 - 35595 [ATAAT]
Sharpness: 0.479,0.52
Strand + :
PBS   : [17/22] 30031 - 30052 (ThrAGT)
PPT   : [11/15] 35215 - 35229
Domain: 31889 - 32416 [possible ORF:31193-35236, (IN (core))]
Domain: 33779 - 34387 [possible ORF:31193-35236, (RT)]

Details of exact match pairs:
35259-35472[214] (1) 35474-35590[117]
29632-29845[214] (1) 29847-29963[117]

Details of the LTR alignment(5'-end):
                            |35259
CATTAGATCTATTACATTATGGGTGGTATGTTGGAATAAAAATCAACTATCATCTACTAAC
||  ||  |    ||| |||   |    |||*|||||||||||||||||||||||||||||
CA--AG--C----ACA-TAT-AAT----TGTTGGAATAAAAATCAACTATCATCTACTAAC
                  **-***----|29632

Details of the LTR alignment(3'-end):
                        35590|*****
ACAATTACATCAAAATCCACATTCTCTACAATAATAGAA--TAATGAA-CGATAACACACA
|||||||||||||||||||||||||||||* |  |||    || ||   || | ||
ACAATTACATCAAAATCCACATTCTCTACA-TGGTAGCGCCTA-TGCTTCGGTTACTT---
                        29963|

Details of the PBS alignment(+):
tRNA type: ThrAGT
GCTTCCAAT----CGG-ATTTG
|||||||||    ||| |||||
GCTTCCAATTTACCGGAATTTG
|30031

Details of PPT(+):
AACAAACAAATGGAT
|35215

While most of the output is straight forward, there are some fields need further explanation.

  1. Score
    Score is an integer varying from 0 to 11. It measures if signals (TSR, TG..CA box, PBS, PPT, IN(core), IN(c-term), RT, RH) occur. Because TG..CA box consists of four parts: TG at 5' end of 5'LTR, CA at 3' end of 5'LTR, TG at 5' end of 3'LTR and CA at 3' end of 3'LTR, there are 11 signals in total. The LTR match score ($match_{score}$) is the sequence similarity between 5'LTR and 3'LTR. It is a decimal between 0 and 1.
  2. Status
    Status is an 11 bits binary string, each bit indicates the status of a certain signal. From left to right, signals are: TG in 5' end of 5'LTR, CA in 3' end of 5'LTR, TG in 5' end of 3'LTR, CA in 3' end of 3'LTR, TSR, PBS, PPT, RT, IN(core), IN(c-term) and RH. If a signal occurs, corresponding position is 1 and 0 otherwise.

  3. Sharpness
    It is a decimal between 0 and 1 to evaluate the fineness of the boundary of LTR region. Higher sharpness means more accurate boundary decision. The first value is sharpness of 5' end and the second is that of 3' end. In a window of length $2W$, Sharpness of the center position is:

    \begin{displaymath}Sharpness = \frac{M_{inside}}{W}-\frac{M_{outside}}{W}\end{displaymath}

    where $M_{inside}$ and ($M_{outside}$) are the number of matched bases in left half and right half window respectively. Put the center position at the LTR boundary to get the sharpness.

  4. PBS & PPT
    For PBS, the first number in square brackets is number of matched bases and the second is total alignment length. For PPT, the first is the number of purines and length of putative PPT. Following is signal positions. String in parentheses is the tRNA type and anti-codon(See this web page for detail: http://lowelab.ucsc.edu/GtRNAdb/legend.html). The minus sign before tRNA type stands for reverse strand(not showed in this example).
  5. Details of exact match pairs
    This section shows the exact math pairs used to construct the LTR alignment. Number in square brackets is the pair length and number in parentheses is the distance between neighboring exact match pairs.
  6. Details of the LTR alignment
    This section shows the alignment details around 5' and 3' boundaries of LTR regions. Single asterisk in `|' line points out putative boundary after the second run boundary decision (see Strategy Section). Other 4~6 continuous asterisks show the positions of putative TSR.
  7. Details of PBS & PPT
    Numbers indicates the 5' ends of signals.

next up previous
Next: Summary output Up: Output format Previous: Output format
2009-04-09